Data & ReproBioinformatics & GenomicsFreedomIntelligence/OpenClaw-Medical-SkillsData & Reproduction

bio-codon-usage

Maintainer FreedomIntelligence · Last updated April 1, 2026

Analyze codon usage bias and optimize sequences for expression.

OpenClawNanoClawAnalysisReproductionbio-codon-usage🧠 bioos extended suitebioos extended bioinformatics suiteanalyze

Original source

FreedomIntelligence/OpenClaw-Medical-Skills

https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills/tree/main/skills/bio-codon-usage

Maintainer: FreedomIntelligence
License: MIT
Last updated: April 1, 2026

Skill Snapshot

Key Details From SKILL.md

2 min

Key Notes

Analyze codon usage patterns and calculate codon adaptation metrics using Biopython.
cai = CodonAdaptationIndex().

Source Doc

Excerpt From SKILL.md

Using CodonUsage Module

from Bio.SeqUtils.CodonUsage import CodonAdaptationIndex

## Generate index from highly expressed genes

cai.generate_index('highly_expressed_genes.fasta')

## Calculate CAI for a sequence

seq = Seq('ATGCGATCGATCGATCGTAA')
cai_value = cai.cai_for_gene(str(seq))
print(f'CAI: {cai_value:.3f}')  # Range 0-1, higher = better adapted

Use cases

Use bio-codon-usage for genomics and bioinformatics workflows.
Apply bio-codon-usage to sequencing, variant, or omics analysis tasks.

Not for

Do not rely on this catalog entry alone for installation or maintenance details.

Upstream Related Skills

transcription-translation - Translate sequences and understand codon tables
sequence-properties - GC123 for wobble position GC content
sequence-io/read-sequences - Parse CDS sequences from GenBank files
database-access/entrez-fetch - Fetch reference gene sets from NCBI for CAI training