bio-crispr-screens-crispresso-editing

Basic Analysis

Goal: Quantify CRISPR editing outcomes from amplicon sequencing of a single target site.

Approach: Align amplicon reads against the reference and guide sequences with CRISPResso, which reports indel frequencies, allele tables, and editing efficiency plots.

## Analyze HDR editing

CRISPResso \
    --fastq_r1 hdr_sample_R1.fastq.gz \
    --fastq_r2 hdr_sample_R2.fastq.gz \
    --amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT \
    --guide_seq CTGCCCACAGGTGAGGAGGT \
    --expected_hdr_amplicon_seq AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGATGCTCGGCTGTGGTT \
    --output_folder hdr_output \
    --name hdr_sample

Batch Analysis

Goal: Process multiple CRISPR editing samples in a single run.

Approach: Define a batch file listing sample names, FASTQ paths, amplicon sequences, and guide sequences, then run CRISPRessoBatch for parallel multi-sample analysis.