AG
Data & Repro
agent-browser
Browse the web for any task — research topics, read articles, interact with web apps, fill forms, take screenshots, extract data, and test w…
FreedomIntelligence/OpenClaw-Medical-SkillsView
Maintainer FreedomIntelligence · Last updated April 1, 2026
Validate primer specificity by BLAST and thermodynamic analysis.
Original source
https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills/tree/main/skills/bio-primer-design-primer-validation
Skill Snapshot
Source Doc
primer = 'ATGCGATCGATCGATCGATC'
hairpin = primer3.calc_hairpin(primer)
print(f'Hairpin Tm: {hairpin.tm:.1f}C')
print(f'Hairpin dG: {hairpin.dg:.1f} cal/mol')
print(f'Hairpin dH: {hairpin.dh:.1f} cal/mol')
print(f'Hairpin dS: {hairpin.ds:.1f} cal/mol/K')
## Check Self-Dimer (Homodimer)
```python
primer = 'ATGCGATCGATCGATCGATC'
homodimer = primer3.calc_homodimer(primer)
print(f'Homodimer Tm: {homodimer.tm:.1f}C')
print(f'Homodimer dG: {homodimer.dg:.1f} cal/mol')
## Self-dimer is problematic if Tm is close to annealing temp
if homodimer.tm > 40:
print('WARNING: Significant self-dimer potential')
Related skills
Browse the web for any task — research topics, read articles, interact with web apps, fill forms, take screenshots, extract data, and test w…
Access 20+ years of global financial data: equities, options, forex, crypto, commodities, economic indicators, and 50+ technical indicators.
Filter alignments by flag, quality, region, or paired status.
Index BAM/CRAM files with samtools index for random access.