Data & ReproBioinformatics & GenomicsFreedomIntelligence/OpenClaw-Medical-SkillsData & Reproduction

bio-read-qc-fastp-workflow

Maintainer FreedomIntelligence · Last updated April 1, 2026

All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.

OpenClawNanoClawAnalysisReproductionbio-read-qc-fastp-workflow🧬 bioinformatics (gptomics bio-* suite)bioinformatics — sequencing & read qcall

Original source

FreedomIntelligence/OpenClaw-Medical-Skills

https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills/tree/main/skills/bio-read-qc-fastp-workflow

Maintainer: FreedomIntelligence
License: MIT
Last updated: April 1, 2026

Skill Snapshot

Key Details From SKILL.md

2 min

Key Notes

CLI: fastp -i R1.fq -I R2.fq -o clean_R1.fq -O clean_R2.fq --html report.html.
All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass.
Preprocess FASTQ reads with fastp" → Run adapter trimming, quality filtering, and QC reporting in a single pass. CLI: fastp -i R1.fq -I R2.fq -o clean_R1.fq -O clean_R2.fq --html report.html.
fastp -i in.fq -o out.fq.

Source Doc

Excerpt From SKILL.md

Adapter Trimming

fastp auto-detects Illumina adapters by default.


## Specify adapters manually

fastp -i in.fq -o out.fq \
      --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

## Paired-end with manual adapters

fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
      --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
      --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT