Data & ReproBioinformatics & GenomicsFreedomIntelligence/OpenClaw-Medical-SkillsData & Reproduction

bio-sequence-properties

Maintainer FreedomIntelligence · Last updated April 1, 2026

Compute sequence properties: MW, pI, hydrophobicity, extinction coefficient.

OpenClawNanoClawAnalysisReproductionbio-sequence-properties🧠 bioos extended suitebioos extended bioinformatics suitecompute

Original source

FreedomIntelligence/OpenClaw-Medical-Skills

https://github.com/FreedomIntelligence/OpenClaw-Medical-Skills/tree/main/skills/bio-sequence-properties

Maintainer: FreedomIntelligence
License: MIT
Last updated: April 1, 2026

Skill Snapshot

Key Details From SKILL.md

2 min

Key Notes

Calculate physical and chemical properties of biological sequences using Biopython.
mw_ds = molecular_weight(dna, double_stranded=True).

Source Doc

Excerpt From SKILL.md

GC at Codon Positions (GC123)

Analyze GC content at each codon position (useful for codon bias analysis):

from Bio.SeqUtils import GC123

seq = Seq('ATGCGATCGATCGATCGATCG')
gc_total, gc_pos1, gc_pos2, gc_pos3 = GC123(seq)

## GC Skew

Calculate (G-C)/(G+C) in sliding windows to identify replication origins:

## Molecular Weight

```python
from Bio.SeqUtils import molecular_weight

dna = Seq('ATGCGATCG')
mw = molecular_weight(dna)  # Single-stranded DNA weight

Use cases

Use bio-sequence-properties for genomics and bioinformatics workflows.
Apply bio-sequence-properties to sequencing, variant, or omics analysis tasks.

Not for

Do not rely on this catalog entry alone for installation or maintenance details.

Upstream Related Skills

seq-objects - Create Seq objects for property calculation
sequence-io/sequence-statistics - File-level statistics (N50, totals)
codon-usage - GC123 for codon position analysis
transcription-translation - Translate before protein analysis
alignment-files/bam-statistics - samtools stats for alignment-level GC and quality stats